MOMA is a Rust framework for exploring number theory, cryptography, and bioinformatics through the lens of Moving Origin Modular Arithmetic.
The crate is designed for researchers and developers interested in a novel, relational framework for analyzing complex sequences.
The inspiration for this crate comes from the concept of a barycenter in astrophysics. Just as the Earth and Moon orbit a common center of mass that is not the exact center of the Earth, MOMA treats modular arithmetic as a system where the "zero point" or "origin" is not fixed.
This origin shifts dynamically based on a contextual value—typically a prime number p—and the chosen OriginStrategy. This provides a novel relational framework for analyzing complex systems.
The original inspiration came from this NASA article: What Is a Barycenter?
The MOMA framework is built on a few simple but powerful ideas:
MomaRing: the primary object for calculations. A ring is defined by amodulusand a chosenOriginStrategy.OriginStrategy: a trait that defines how the origin moves, making the framework highly extensible.- Analysis tools: a suite of modular tools for deeper analysis.
- Number theory:
MassField,OriginDrift,CompositeInfluence,CompositeDampener,GoldbachProjector,Entropy, andResonanceFinder. - Bioinformatics:
BioSigAnalyzer,CodonTable, andMutationfor mapping numeric signatures to biological events.
- Number theory:
- Flexible Core: A powerful and extensible system based on the
MomaRingandOriginStrategytrait. - Advanced Analysis Tools: A suite of high-level structs for statistical, number-theoretic, and bioinformatics analysis.
- Cryptographic Primitives: Demonstrates how MOMA can be used to build components like a Key Derivation Function.
- Prime Number Utilities: A helper
primesmodule for primality testing and prime generation. - Pure Rust: Built with safe, idiomatic Rust.
Add MOMA to your Cargo.toml:
[dependencies]
moma = "0.4"or simply run:
cargo add momaMOMA is a toolkit for exploration across different domains.
Use the ResonanceFinder to find primes where the MOMA signature is a multiple of another property of the prime, such as its number of prime factors (prime_factor_mass).
use moma::resonance::ResonanceFinder;
use moma::strategy;
use moma::primes;
// Find primes where the signature (using CompositeMass strategy)
// is divisible by the prime factor mass.
let finder = ResonanceFinder::new(
100,
strategy::CompositeMass,
primes::prime_factor_mass,
);
// Search for resonance events in the range 1 to 500.
let resonances = finder.find_in_range(1, 500);
println!("Found {} resonance events.", resonances.len());
for (prime, signature) in resonances {
println!(" - Resonance at p={} with signature {}", prime, signature);
}Use the BioSigAnalyzer to map MOMA signatures to simulated genetic mutations.
use moma::biosig::BioSigAnalyzer;
use moma::strategy;
let analyzer = BioSigAnalyzer::new(60, strategy::CompositeMass);
let dna_sequence = "AGCTGCGATCGTACGATCGATCGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCT";
// Analyze the mutational effect of the signature derived from prime 13.
if let Some((signature, mutation)) = analyzer.analyze(13, dna_sequence) {
println!("Signature for p=13 is {}", signature);
println!("Resulting mutation type: {:?}", mutation.mutation_type);
}There are more examples in the GitHub repository, including:
- Cosmology - for astrophysics-oriented exploration
- Bioinformatics - for biological and sequence-based models
- Prime Gaps - for number-theory-focused experiments
- Goldbach Projector - for Goldbach conjecture investigations
- Origin Drift - to understand how a MOMA origin drifts over time
- Key Derivation Function (KDF) - for cryptographic-style experimentation
- Mass Field - for building a mass field across a chosen range
Neil Crago
Contributions are welcome. If you have an idea for a new OriginStrategy, an analysis tool, or find a bug, please feel free to open an issue or submit a pull request.
This project is licensed under either of:
- Apache License, Version 2.0 (LICENSE-APACHE)
- MIT license (LICENSE-MIT)
at your option.
This crate is part of a collection of crates by the same author: These include:-
- MOMA_simulation_engine
- Fractal_Algebra
- tma_engine
- factorial_engine
- fa_slow_ai
- coheron
- curvature
